Sound installations

Florian Dombois: Circum Pacific 5.1 (2001), sound installation

Technical basics: Five seismic stations located around the Pacific (Russia, California, Easter Island, Antarctic, Papua New Guinea) whose configuration around the globe corresponds roughly to a surround sound 5.1 system. Three weeks of continual measurements (01/01/2001–21/01/2001) of the on-site seismometers were compressed to yield nearly fourteen minutes of audified sound material.

Artistic concept: In the winter of 1988/89, I worked at the Hawaiian Volcano Observatory, in the middle of the Pacific Ocean. It is here that the seismic waves of the so-called “Ring of Fire” intersect, the most active tectonic zone encircling the Pacific. How would it sound if this permanent activity were compressed into one space? What the gaze through the viewfinder is for the photographer is the data time-window for listeners to Circum Pacific 5.1. And just as motifs can be positioned in a photograph, one can also arrange sound events in the audified recording.

Descriptions in: Peter Kiefer (ed.): Klangräume der Kunst, Heidelberg 2010, p. 337. Dieter Daniels, Sandra Naumann (eds.): Audiovisuology 1: See This Sound, Cologne 2010, p. 292.

http://www.auditory-seismology.org/version2004/distance.html

Florian Dombois

Florian Dombois, Seimic waves travelling across the earth (1999/2017). S. a.:http://www.auditory- seismology.org

Julian Klein / a rose is: Brain study (2001–2004), installation for networked brain-players, multi-channel installation derived from the radio version (2001)

Brain study is a sound installation which presents a spatial model of the human brain. The foreignness of the brain’s biological function, something which can be considered as vastly different to our lived experience, will be sensorially presented. The neural activity of the brain-players will be monitored using an EEG (Electroencephalography) and translated into sound via live-electronics. With the help of this acoustic neurological feedback, the brain-players will be trained to actively influence their own EEG waves and in turn intentionally produce sounds. The biological rhythms and spectra stay unchanged. They will become acoustically amplified and form the musical structure of the entire installation.

An ensemble of five brain-players, who are connected with one another via network connection, forms a model of the human brain. They will be able to hear their own activity, and through the condition of their own brains, will be able to influence the acoustic perception of their fellow players. The result is a neurological network of brains, which itself behaves like a brain: it can process and react to events, recall memories and possesses emotional states, such as fear, happiness, stress and euphoria. After an embryonic phase of learning, the brain model is left to its own devices. The main part of the installation consists of the live-activity of the system, which is able to perceive, associate, evaluate and remember.

In the installation the functions of this model are anatomically ordered depending on their position in the head. The listeners themselves will be central components of the installation: they will perceive the biological structure of their own perceptions.

Concept and realisation • Julian Klein, Neuro-electronics • Marc Bangert, Audio-electronics • Gregor Schwellenbach, Sound • Lothar Solle, Dramaturgy • Christoph Buggert, Brains • Christian Buck, Sara Hubrich, Kristina Lösche-Löwensen, Eva Müllenbach, Ulf Pankoke, Production of Hessischer Rundfunk 2001

Julian Klein

brain model

a rose is: Brain Study. Probe with Ulf Pankoke, Film still by Daniel Kötter (2004)

Jutta Ravenna: SesamSesam (2017), interactive sound sculpture

During the festival a temporary network for a Data Soundwindow, made out of translucent circuit boards, will be installed in the Villa Elisabeth. Here the festival visitors can sonify the activities and events of their mobile devices in real-time. Through this sonification, the data of their interaction and communication behaviour becomes observable incidents, which develop, endure, then fade away. Data such as duration of stay, login, logout time, send and receive is sonified. The Data Soundwindow will function like a massive display, reacting visually to the web traffic. Several oversized number and text displays are integrated into the large-scale object and will correspond with various activities on the network.

Jutta Ravenna’s SesamSesam sonifies WLAN traffic in order to make possible, over physical experiences with data, the kinaesthetic perception of auditory input for the listener. The public will become part of the work itself, as it involves producing data for a 3D sound space and listening to the network presence in the data space, but ultimately to physically influence the auditory atmosphere. This happens in front of the Data Soundwindow through a 3D sensor, which scans the nearby gestural interactions, movements and paths through the sensor-space and turns the sound sculpture into an instrument. Within the conical sensor-space the constantly changing sound can be freely moved across three dimensions, allowing it to glide, rotate, gently oscillate or sharply pulse. The visitors explore these ‘kinetic objects’ with their bodies in the sensor-space, and at the same time their movements draw lines of sound into space. In this kinesthetic perception of sound, the experience of embodiment and formal algorithms entwine. Maurice Merleau-Ponty provides a fitting ending: “And finally, far from my body’s being for me no more than a fragment of space, there would be no space at all for me if I had no body.” (Maurice Merleau-Ponty: Phenomenology of Perception [1949], trans. Colin Smith, Routledge: London, 2005, p. 117.)

Technical realisation • Liang Zhipeng, Timo Engel and Josef Heinrich

Jutta Ravenna

Jutta Ravenna, Data sound window (2017)

Jutta Ravenna, Data streams

Martin Hachmann: Angst. Sonification for Chairs and Floor (2017), kinetic sound installation

Commissioned by BGNM

The installation takes its influence from the social and socio-cultural aspects which surround the phenomenon fear. The installation uses data taken every year since 1984 by the German Socio-Economic Panel (SOEP). The goal of the SOEP was to create a large database which would allow them to investigate and analyse socio-economic issues in Germany. The level of objectivity regarding such information is problematic at best: firstly, questions related to the issue of fear within society are extremely difficult to answer, with the subject matter being extremely varied and difficult to measure. Secondly, a database is never neutral, as it always carries the fingerprints of those who create it. Analysis and representation are unavoidably interpretive. In this context, how do we define fear? Fear is a temporal phenomenon. It is a phenomenon whose basis is the ability to simultaneously be aware of a possible future and feel hopeless.

According to Martin Heidegger (Sein und Zeit / Being and Time, 1926), its presence is constantly neglected. Fear is a continually present repetition. Fear of the unknown. Fear of meaninglessness, or like Søren Kierkegaard describes in The Concept of Anxiety (1844), a reality of nothingness. Fear as an inner conflict spurred by the doubt of who we are. As a collective phenomenon, fear conditions our very disposition to it. The will not to know. With knowledge comes guilt. Social anxiety can – even when subconscious – be understood as an attempt to preserve our innocence. Presumed information about levels of knowledge, perceived emotional states or measurements of subjective happiness let us know something about the effects that fear has on society. Through the use of questionnaires, the SOEP has attempted to track the chronological development of fear in society. They have observed concrete changes in the number of books in a household, the balance between feelings of fear and happiness as well as individual satisfaction with the general development of prosperity within Germany. These observations have been condensed into three numerical progressions. The ability to divide a yearly survey into monthly questionnaires means that each year provides twelve values. During the installation, one year from the SOEP’s database will be presented in 365 seconds. Thus, the run-time for a 32-year period is estimated at around 3 hours and 15 minutes.

An aural environment will be created by means of a kinetic sculpture. Three chairs will be used to correlate with the three sets of data taken from the SOEP. Each chair should represent one aspect of the society. The chairs are seemingly similar, each attached to a motor’s shaft at the bottom of the seat. As the motor turns so does the chair, through which the friction between chair leg and ground leads to a continuous rubbing sound. The speed of the motors is in direct relation to the sets of data taken from the SOEP database. The highest speed of the motor per second correlates to the maximum value from the entire database of the 32-year period. The inertia created through the friction allows the values to smoothly cross-over with one another. The result is a seemingly oppressive sound mass whose intensity grows and diminishes in correlation to the amount of fear represented in numbers. The sound mass produced by the movements of the chairs remains of course blurry and unclear – much like the phenomenon of fear itself.

The sound installation was kindly supported by the German Socio-Economic Panel at DIW Berlin, especially Knut Wenzig and Dr Jan Goebel.

Martin Hachmann

Martin Hachmann, Prototype for fear (Juli 2017)

Martin Hachmann, early design sketches for Fear
(Juli 2016)

YoHa: Lungs: Slave Labour (2005), sound installation

Lungs is a memorial to the 4,500 slave labourers that worked in Hall A of the former Deutsche Waffen- und Munitionsfabriken AG during the Second World War (now the main exhibition hall of ZKM | Center for Art and Media Karlsruhe). By computing the vital lung capacity of these forced workers, the program emits their last breath of air.

The Lungs project is based on ways of bridging the gap between the perception of data and social experience. The aim is to take computer records of local events or communities that have been reduced or demeaned to the status of information – mere numbers – and to allow the people to re-experience and/or recover their own value. The term “Lungs” refers to the technique of giving a database a pair of lungs by calculating the human lung capacity that is represented by the individuals in that dataset and “breathing out” the result through an audio system. This method of crossing a software machine with a human machine was implemented here as a software memorial to the slave labourers who worked in the ex-munitions factory in Karlsruhe, Germany.

With thanks to the Generallandesarchiv Karlsruhe for providing us with anonymous data about these former forced labourers. The database containing records of over 57,000 foreign workers was set up in 2000 to help answer enquiries from affected persons and from the foundation Remembrance, Responsibility and Future. Even to this day, many of the entries have still not been historically reappraised, nor have the individual fates of labourers been appropriately acknowledged.

Lungs: Slave Labour was first exhibited at the Making Things Public show at ZKM, Karlsruhe, 2005. It has since been purchased for their permanent collection “Masterpieces of Media Art”.

Matsuko Yokokoji, Graham Harwood

YoHa, Lungs: Slave Labour (2005)

 

YoHa, archive material

Source: http://www.landesarchiv-bw.de/web/45605

Sound Vitrine

Terry Fox: Berlino (1988), a compilation of pre-recorded tapes, performed and recorded by Terry Fox (realisation of Berlin Wall Scored for Sound [1980] for record)

(for Mitsuko Natori)

Record (Apollo records AR088807)

Mastered at Tango Studio Eindhoven, 18 August 1988

Mastering engineer: Henk Janssen

Produced by Terry Fox  and Het Appolohuis, Eindhoven, Netherlands

Terry Fox: Berlin Wall Scored for Sound and Berlino

In 1980/81 I lived as a guest of the DAAD in Berlin. Throughout those eighteen months I had a studio in the Künstlerhaus Bethanien, Mariannenplatz, Kreuzberg, next to the Wall. From the chimney top of that building I could look down into the Wall and follow its course for a long way in both directions. I could see how it bisected streets, squares and even houses. To become better acquainted with my new situation I decided to make a sound map, a score, a kind of aural geography of this structure. On a large map I located four ‘corners’ in the Wall surrounding West Berlin. These corners or ‘points’ thus divided the Wall into four sections. A straight line was drawn through each section from point to point, the map of Berlin became a very long straight line with the pattern of the Wall zig-zagging and looping through it. Four more lines were drawn, evenly spaced and parallel to this center line, two above and two below, creating a musical stave. The entire length of the Wall was measured from the map in centimeters. The centimeters were then transposed into seconds so that distance became measured time. The topographical or geometrical peculiarities of the Wall were then divided into five categories and assigned letters (E, G, B, D, F).*

One strange formation of the Wall, resembling the Horsehead Nebula (in the constellation Orion), was given its own letter: X. The six categories of Wall became: curved or crooked (E), straight (G), chaotic (B), canal (D), lake (F), and Horsehead Nebula (X). The complete score, for six different sounds, is endless, forming a loop, like the Wall it describes.

For the version of the score realized on this record I chose six sounds from fragments of audio tape I had on hand. These are from cassette tapes of private studio activity. All of the sounds are acoustic and recorded with an open microphone. No ‘pick ups’ or ‘contact mics’ were used.

The six sounds are:

E) The sound of an instrument being bowed in a large cavity beneath a sidewalk in San Francisco. The overhead end of a vertical piano wire is attached to the underside of a steel freight elevator door in the sidewalk. The lower end of the wire is attached to a large metal box and provides tension and resonance for it. The wire is stroked with two violin bows. San Francisco 1978.

G) The sound of two parallel piano wires four meters long. They are attached at either end to a wooden floor and pass over wooden bridges. They are beaten with a long chopstick held in one hand and inserted between the wires. Liège 1988.

B) The sound of the British Military helicopter which made almost daily passes along the wall at Mariannenplatz. This pass was taped from a window of my studio. Berlin 1980.

D) The sound of a single piano wire attached at one end to the metal frame of my studio window and stretching ten meters to the opposite corner where it was attached to a wooden cupboard. The wire is rapidly bowed, using a very thin steel bar. Berlin 1981.

F) The sound of rain, thunder and bells of the church at Mariannenplatz taped from my studio window. Berlin 1980.

X) The same instrument as (E) but taped on a different day when it made a sound as strange as a shape of the Horsehead Nebula.

Terry Fox (Liège, August 1988) (Published on the record sleeve and republished in: Terry Fox: Works with Sound / Arbeiten mit Klang, edited by Bernd Schulz, Heidelberg: Kehrer, 1999, p. 78.)

* Terry Fox probably referred to the alphabet letters in the order of the stave-lines of the violin-clef. He might have remembered the rhyme used for piano students to memorize the names as an acronym: “Every Good Boy Deserves Favor” or “Every Good Boy Does Fine”. Information by Marita Loosen-Fox.

Dance Performance

Tomoko Mio: Dancing Sound – Conducting Data (2017), three dances with an interactive sound sculpture

During the dance performance with Jutta Ravenna’s interactive Datasoundwindow SesamSesam (2017), the role of the dancer will be twofold: first, to create a dance to music which does not yet exist, but will only emerge from the sonified data while the dancer dances. Second, to modify the emergent sound through bodily gestures, like a conductor.

The dance with the spatial sculpture enables the interaction of architectural, sensorially prepared and digital spaces. This in turn allows the visitors to freely switch their attention between those spaces. Above the Datasoundwindow, a centrally located sensor scans the dance moves in three dimensions and makes new spatial movements and sound effects possible. Due to advanced digitalization, minimization and increased complexity, the basic electronic circuits contained in Ravenna’s data sculptures became increasingly immaterial. The artist has therefore created an installation version of her data space as part of her interactive work SesamSesam.

Through her explorations of movement sequences and dance, Tomoko Mio also deals with space. Jutta Ravenna is interested in how the bodily presence of the dancer influences the data space. All dance actions, including rotation, linear or pointillist trajectories and poses or positions are translated into something audible. Technical aspects of the work were developed experimentally by Liang Zhipeng, Tomoko Mio and Jutta Ravenna. The Ravenna-Tomoko collaboration consists of Ravenna’s modular choreographic instructions and Tomoko’s creativity as a dancer and choreographer.

The sensor’s range has a conical form with the following dimensions: height, breadth, depth, volume and form. This ‘room’ is programmed to react to the movement of singular body parts, such as the head, shoulder, hand or knee. Turning, stepping or springing occur spontaneously or in reaction to the constantly transforming sensorial surroundings. The movements are not choreographed and happen as a consequence of this process or intuitively, similar to an improvisation. The connection between dance and the movement of sound means that a certain “listening whilst moving” is required from the dancer, as well as a large physical presence. These skills are also required in order to adapt to the placement of sound objects within the structure of the three-dimensional sound installation.

Movements within the sensorially prepared room call upon events from the internet. Through their voluntarily recorded internet activity, the visitors provide necessary input for the installation: with every login a new frequency from a pre-defined pool of possible frequency deviations will be added to the sound image. Before reaching the Datasoundwindow, the sonified data will be split and divided in relation to its distance from the object within the sound zones. The dancer explores the kinetic objects in the sensorial room with her body. Simultaneously, her movements will be audibly traced in the form of sound trajectories in space. Through a temporary WLAN network, the visitors’ data, such as login, logout, duration, time, “send” and “receive”, will be sonified and as music forms a “digital stage” for the dance.

Ravenna’s sculptural instrument of audible data streams provides the dancer with a real-time autonomous co-performer. The interactive sound installation SesamSesam enables the dancer – or member of the public – to kinesthetically experience the auditory: body movements are directly correlated to the spatialisation of sounds within the sensor room.

Jutta Ravenna and Sabine Sanio

Jutta Ravenna, draft for SesamSesam: sensor room with dancer in front of the interactive sound sculpture Data Soundwindow (2017)

Soundbar

The Soundbar offers a headphone-based, individual listening experience, which the visitors of the festival can take advantage of between the concerts and symposiums. The Soundbar was developed in close cooperation with the artists of the festival and provides the listeners with a chance to hear short excerpts of the presented works. Selected examples of other compositions which thematise sonification will also be available. For each example there will be information provided, such as the artist’s name, title of the work, year, data source, method of sonification and genre/format. The category “genre/format” distinguishes between compositions, sound installations, performances and object works. The “method of sonification” refers to sub-categories of sonification, such as “audification”, “parameter mapping” and “model based sonification”. In his interview with Volker Straebel, Florian Dombois provides an interesting overview of the differences between these various sub-categories. The audio-interview can be accessed in the Auditory Perspectives section of the online journal kunsttexte.de (issue 2/2011). According to Dombois, “audification” is the direct conversion of a signal’s waveform into sound, e. g., the playing of a vinyl record, whereas “parameter mapping” is the allocation of sounds to a specific data point. Lastly, in “model based sonification” the parameters condition a body of sound. Different modi are audible depending on which parameters are chosen, like sonar pulses or the beeps that indicate the intervals between heartbeats on an EKG machine.

The Soundbar is a collaborative project of the ZKM | Center for Art and Media Karlsruhe, Deutschlandfunk Kultur, www.sonifyer.org and the Sonification Festival.

Jutta Ravenna

http://www.sonifyer.org/wissen/sonifikationmusik/

Soundbar

sonification of the comet 76P/Chryumov-Gerasimenko, Manuel Senfft 2015

https://soundcloud.com/esaops/a-singing-comet
„Rosetta’s Plasma Consortium (RPC) has uncovered a mysterious ‘song’ that Comet 67P/Churyumov-Gerasimenko is singing into space. The comet seems to be emitting a ‘song’ in the form of oscillations in the magnetic field in the comet’s environment. It is being sung at 40-50 millihertz, far below human hearing, which typically picks up sound between 20 Hz and 20 kHz. To make the music audible to the human ear, the frequencies have been increased in this recording.“ Original data credit: ESA/Rosetta/RPC/RPC-MAG. This sonification of the RPC-Mag data was compiled by German composer Manuel Senfft (www.tagirijus.de). Thumbnail image credit: ESA/Rosetta/NAVCAM – CC BY-SA IGO 3.0

Concert: Loudspeaker and Live-Electronics

Eliza Goldox, Jasmine Guffond and Holger Heissmeyer: From Cloud to Fog – A Sonification of Digital Traces (2016), interactive performance

Selected by BGNM

“Fog is a vital response to the imperative of clarity, transparency, which is the first imprint of imperial power on bodies. To become foglike means that I finally take up the part of the shadows that command me and prevent me from believing all the fictions of direct democracy insofar as they intend to ritualize the transparency of each person in their own interests, and of all persons in the interests of all. To become opaque like fog means recognizing that we don’t represent anything, that we aren’t identifiable; it means taking on the untotalizable character of the physical body as a political body; it means opening yourself up to still-unknown possibilities.” Tiqqun, The Cybernetic Hypothesis

From Cloud to Fog is an experiment dealing with trust and control within the power dynamics inherent to the transparency society (Byung-Chul Han) and movements across the virtual realm. It is presented as a participative performance and sound installation connecting motion tracking and collective movement, focusing on the intangibility of digital monitoring and translating digital behavior.

In the guise of aerobic instructions, movement is tracked and the body is used as a point of analysis, revealing habitual trust and repetition with others. These scripted gestures, which we perform everyday individually, become a collective act of imitation. The captured data is translated into sonic rhythms as a method of interpretation, creating an ongoing ritual and soundscape.

The performance instructions include the project “Unpatentable Multi-touch Aerobics” – an Aerobics routine by Liat Berdugo and Phoebe Osborne. https://fleeimmediately.com

Eliza Goldox

Eliza Goldox, Jasmine Guffond and Holger Heissmeyer, From Cloud to Fog, Spektrum Berlin, Juni 2016. Foto: Willan Octave-Emile

Hans Tammen: Conflict of Interest (2017), live-electronics

Premiere

A few years ago I downloaded my own DNA analysis from a genomics laboratory. Of course, I was interested to see if I’d die soon (luckily not), or where my ancestors came from (no new revelations here, and those who know me wouldn’t be surprised that the lab found 2.7% of my genes come from Neanderthals). However, I was more interested in making art with it. After all, the set contained over 600,000 lines of data, and that should be a gold mine for an artist interested in algorithms. As this festival will be the first opportunity to present Conflict of Interest to the public, it is worth detailing some of its background, even if at the point of writing this (June 2017) some of the details may eventually change.

The most interesting aspect of a person’s DNA data is that each line actually has a specific “meaning”, and cannot be treated as a simple continuous stream of bits & bytes.

Why does that matter? Projects that turn data into sound or visuals often suffer from the artist’s desire to find something inherent in the data structure that determines the aesthetics (which an old friend of mine [Hi, Martin!] once shrugged off as composers being too lazy to create original works). As a union technology consultant in the 1990s, I argued in front of German works councils (“Betriebsräte”) that data is just data, but becomes “information” as soon as it is interpreted by the company’s executives. I argued that an employee working in a call center, logging out of their system to go to the bathroom more often than the average, does not mean anything, but the way his/her superiors interpret this fact according to their own prejudices may have certain consequences for the employee. How data from workplace monitoring is interpreted depends on the company’s approach to power.

I continued this line of thinking as a residency program officer and consultant for artists who wanted to work with data sonification and visualization projects, trying to emphasize that it is the artist who makes aesthetic choices, not the data. A common pitfall is to simply connect different physical realities (composers like to use numbers mapped onto frequency or pitch), and then letting the system run without further involvement from the artist. If it is then accompanied by outlandish claims one ends up in New Age territory, such as “G# is the frequency of the moon”, as if revolving objects and sound waves are somehow the same. One just needs to multiply the number of days the moon revolves around the earth often enough to end up in the audio range. Supposedly, G# is good for sexual energy – no kidding, just google it.

There is of course nothing wrong with mapping one stream of numbers onto another – after all that is one thing a computer is good at. The point is, there is no “meaning” in numbers. The goal of the artist is to make connections freely, but not to make outlandish claims.

The lines in my DNA analysis include a variety of data. Probably best known is the genotype (a string of letters such as AGCTCTAGACTTGGCTAAAGCCAA…). Some genome sonification projects seem to focus on that one in particular, maybe because one can easily work with it as a continuous data stream of As, Gs, Cs and Ts. Too bad “T” is not a pitch, though.

But there is more to be found, and it is here where the aforementioned “meaning” comes into place. Each line contains (1) the RSID identifier for a genetic variation (SNP), (2) on which of the 23 chromosomes it is located, (3) its position on that chromosome, (4) the genotype. This is how a typical line out of the 600,000 looks like:

rs147226614 – 1 – 878697 – GG

We don’t know what many of these genetic variations are good for. Some of them may be junk, some have been established as having a function within our bodies, others only work together in groups. It makes no sense to use any of that data for an artistic project without considering what we know about these gene variants specifically. I may also use additional information (e. g. on which of the 23 chromosomes it can be found, and its particular location on that chromosome), but first I need to examine what we do know about the SNPs.

Luckily, there are lots of studies to be found linking SNPs to certain traits or conditions. Even better though is that these can be found in publicly available research databases, and what I want to know can usually be found in the abstract or the keywords. In those databases SNPs are referenced by their RSIDs, including the location on which chromosome they were found. It shouldn’t be a problem to write a piece of software that cross-references RSIDs, plus location found in my data with those found in research articles, in order to see what we can do with that information. It may even be possible to do this analysis in real-time during performance, after I have determined what I am eventually looking for.

Most of the studies found in research databases are of course related to diseases and conditions, such as prostate cancer, Alzheimer’s, migraine or Parkinson’s. References, however, can also be found to more generic information such as height, bitter taste response, body mass index, or being a morning person. It is possible to see, for example, if a specific variant may be connected to suicidal behavior or alcohol dependencies. Many research projects reference the population surveyed. Oh, and there is a lot that I have no clue about.

So, the first step is to cross-reference my DNA with the data available in these research databases, and only keep those records that match. It is at the next step, though, where the composer comes in: As soon as I make a decision regarding which keywords or strings of text to use, I am crossing the line from “data” to “information” – or to put it another way: where art begins. “Cleft lip” may not be part of my project, but there are many entries I could focus on. Diseases? Bodily features? Susceptibility to specific drug ingredients? What happens if the SNPs in my data set are referencing population segments I have no connection with, such as “Chinese psychiatric patients” or “North Indian Agrawal population”? It is also possible to use information I already have from the gene lab, information that cross-referencing research databases may not yield. This can all be further complicated by the fact that a single SNP may not alone be responsible for a specific trait, e. g. the information (for what it’s worth) that I’m not likely to have cheek dimples. The lab used 9 markers fed into their statistical model to determine that there is a 62% chance of me not having dimples and that 63% of Europeans don’t either.

Eventually, I should have clusters of information I can work with, grouped by their specific traits or research keywords. Groups of sounds – played, pre-recorded or generated – will be assigned to each cluster, but the number of SNPs associated with that cluster, its position on a specific chromosome, and allele (AA, AC, TC, etc.) may all be part of the algorithm that determines how it will be used.

For the playing, processing and spatialization of sounds, the plan is to use software from my Endangered Guitar project. Developed since the year 2000, and presented in hundreds of concerts, the “Endangered Guitar” is a hybrid interactive instrument meant to facilitate live guitar sound processing. [Explained in detail in Hans Tammen: “Case Study – The Endangered Guitar”, in: Till Bovermann, Alberto de Campo, Hauke Egermann, Sarah-Indriyati Hardjowirogo, Stefan Weinzierl (eds.): Musical Instruments in the 21^st century. Identities, Configurations, Practices, Springer 2016. The article alone can be found here: http://tammen.org/musical-instruments-in-the-21st-century-endangered-guitar/ (last accessed: 2 July 2017).]

An actual guitar might, however, not be part of the performance. Over the years the software has been extended to allow for other pieces and projects – and is now able to process input from other sound sources, play and process samples stored on the computer’s hard-drive and use any external controller imaginable. It has become my general go-to piece of software for the creation of sound works, whether there’s a guitar connected or not.

As for the live processing of sounds, a cursory check shows that the system is currently set up to control approximately 100 parameters across its entirety. Of course, nobody could actually control 100 parameters consciously and in real-time. However, they are already set up and ready to go, so any incoming control value – in this case, from my DNA information clusters – could be routed to any of these parameters. The data is used to determine the sounds played and to control the parameters of the processing at the same time.

As a third layer, this data set might also be used to make it an interactive performance – the Endangered Guitar software is also an interactive system. 30 years ago, Joel Chadabe described an “interactive composing system” as one that “operates as an intelligent instrument – intelligent in the sense that it responds to a performer in a complex, not entirely predictable way adding information to what a performer specifies and providing cues to the performer for further actions”. [Joel Chadabe: “Interactive Composing”, in: Computer Music Journal VIII:1 (1984), p. 23.] My software “listens” to the input and then determines the parameters of the electronics that process the same sounds, but responds in a flexible way – as I deliberately programmed unpredictable or “fuzzy” elements into the software.

While each performance features elements that were developed over decades of performance practice (the choice of the actual sonic material, order and timing of parts, how to transition from one part to the other, when to make sharp cuts, dynamics and other elements of the form), the software that interferes with the predictable order of events makes it an improvisation, in that it forces the performer to deal with unforeseen circumstances. In addition to the available strategies I can add my DNA dataset to influence the performance, increase the unpredictability of the software’s behavior and throw the performer off his (well, my) path.

Hans Tammen

Hans Tammen, Foto: Vavarella

Alberto de Campo: Navegar é Preciso (2006), multi-channel

(Navegar é Preciso was composed for the concert call “Global Sound – The World by Ear” at the 2006 ICAD conference, which invited auditory representations of global social data.)

Navigation as a practice and as a system of knowledge has exerted major influence on the development of the world. The first successful circumnavigation of the globe by Fernão de Magalhães (Magellan) proved beyond all scholastic doubts that the earth is in fact round. This would not have happened without the systematic cultivation of all the related sciences in the school for navigation, map-making and ship-building founded by Henry the Navigator, King of Portugal during the 15^th century. Thus, Magellan’s Route became an intriguing choice for the temporal and spatial organization of this work.

Leaving Seville in 1519, five ships under captain Magellan crossed the Atlantic Ocean to anchor near present-day Rio de Janeiro. More than three years later, only one ship returned home, with 18 survivors, 237 crew members and their captain having died on the journey. One is reminded of a song, Os Argonautas (1969) by Caetano Veloso: “Navegar é preciso, viver não é preciso” (“Navigating is necessary, living is not”).

The explorers in the early 15^th century were interested in spices (which Europe was massively addicted to), gold, and the prestige earned by gaining access to good sources of both. Nowadays, other raw materials are considered premium goods. We chose to focus on two main dimensions: one depicting economic characteristics of every country we pass, and another informing us about its inhabitants’ current access to drinking water.

Sonification of income inequality

In 1980, the head of a company located in the US earned 42 times as much as an employee – by the year 1999, this ratio was more than ten times higher: a company leader earned 475 times more than an average employee. The Gini index is an economic measure that captures aspects of income inequality: The higher the Gini index, the higher the income differences between the poorer and the richer parts of a society. A value of 0 means perfectly equal distribution, while 100 means that one person gets all the income of the country and the others have zero income. However, the Gini index does not report whether one country is richer or poorer than the other.

Our sonification tries to balance the limitations of these two variables by combining them: We include two factors that go into a Gini calculation, the ratio of the top and bottom 10% of all incomes in a population, and the ratio of the top to bottom 20%. In Denmark (ranked 1 of 124 nations on the Gini index), the top 10% earn 4.5 times as much as the bottom 10%, for the UK (rank 51), the ratio is 13.8:1; the US (rank 91) ratio is 15.9:1 and Namibia, ranked last of 124, has a ratio of 128.8:1. Missing values in these variables are replaced by a dense cluster of near-center values, which is easy to distinguish acoustically from the known distributions.

Sonification of access to drinking water

“Estimated percentage of population with access to improved drinking water sources total” is one of the “Social Indicators” reported to the UN Statistical Division by the national agencies of the UN member states. Unfortunately, this indicator has a high percentage of missing values (46 of 190 countries, 24.2%). Of the countries reached by our route, 16.3% (31 countries) are missing these data; we chose to replace them by estimates based on data of the neighboring countries.

Mapping choices

Every country is represented by a complex sound stream composed of five resonators; all parameters of this sound stream are determined by (a) data properties of the associated country and (b) the navigation process, i. e. the ship’s current distance and direction towards this country.

At any time, the 15 countries nearest to the route point are heard simultaneously. This is both to limit display complexity for the sake of clarity, and to keep the sonification within CPU limits for real-time interactive use.

The mapping choices in detail are:

• Population density of country: density of (random) attack triggers in the sound stream
• GDP per capita of country: frequency center (and most prominent resonant pitch) of the stream
• Ratio of top to bottom 10% of incomes: pitches of the outermost two ‘satellite’ resonators (the top and bottom pitches of that stream)
• Ratio of top to bottom 20% of incomes: pitches of the inner two resonators (Missing values for these two become dense clusters.)
• Water access: decay-time (Short tones mean less access (drier), long tones mean more access to clean water.)
• Distance from the navigation point: volume and attack time (Far away streams are softer and more ‘blurred’.)
• Direction: the spatial direction of the stream in the loudspeaker rendering (North is kept constant.)

The movement and conditions of the navigation – ship speed, direction, storm and calm – are represented very directly as spatial direction, brightness, intensity, and liveliness of wind-like noise.

The following list of times and locations provides some points of orientation that can be recognized while listening to the piece.

0:00–0:10       Very slow move from Sevilla to San Lucar

0:20–0:26       Cape Verde: very direct sound (i.e. near the capital), rather low, dense spectrum (poor country, unknown income distribution)

0:54–1:00       Uruguay/Rio de la Plata: very direct sound, passing close by

1:05–2:40       Port San Julian, Patagonia: very long stasis, everything is far away, 4 + 2 months long winter break in Magellan’s travel

2:45                 Moving into Pacific Ocean: new streams, many dense spectra; unknown income distribution

3:20                 Philippines: very direct sound (near capital), high satellites: unequal income distribution … Moluccan Islands

4:00                 Brunei: very direct, high, dense sound: very rich, unknown distribution … Moluccan Islands

4:50                 East Timor: direct, mostly clicking, only very low frequency resonances (very poor, little access to water, unknown income distribution)

5:15                 Into Indian Ocean: ‘openness’, sense of distance

5:50                 Approaching Africa: more lower centers, with very high satellites: poor, with very uneven distributions (but at least statistics available)

5:55                 Pass Cape of Good Hope: similar to East Timor

6:10                 Arrive back at San Lucar, Spain

Alberto de Campo und Christian Dayé (shortened text from the Proceedings of the 12th International Conference on Auditory Display, London, UK, 20 to 23 June 2006)

Route of Magellan’s circumnavigation, from Antonio Pigafetta, Primo Viaggio Intorno Al Globo Terracqueo (1530, Reprint 1800). Graz University Library

http://turbulence.org/project/heat-and-the-heartbeat-of-the-city/

Andrea Polli: Heat and the Heartbeat of the City (2004), 4-channel

The earth’s atmosphere is becoming warmer, and a climb in global temperatures is already causing sea levels to rise around the world. This is likely to bring an increase in the number of hurricanes and tsunamis already occurring around the world. In 2004, I worked with climate change data from the New York City region in collaboration with Dr. Cynthia Rosenzweig, Dr. David Rind and Richard Goldberg at the NASA Goddard Institute for Space Studies and the Columbia University Climate Research Group. These scientists created an atmospheric model of the city, which is considered as one of the most detailed models of any urban area. The model allows them to predict how climate change will affect New York and its surrounding suburbs. They provided me with archived data for several locations from the summers of the 1990s, along with projected data for the summers of New York in the 2020s, 50s, and 80s, formatted especially for the creation of sonifications. With this data, I created a series of sonifications attempting to convey the physical experience of the increasing temperatures.

Andrea Polli

Sound artist Andrea Polli at work in the weather tower at Williams Airfield near McMurdo Station.

Foto: Tia Kramer

Johannes Kreidler: Charts Music (2009), music with visualisation

Charts Music is a sonification of stock exchange values and other political statistics relating to the climax of the financial crisis (January 2009). Charts have been transferred into melodies, which were in turn fed into the children’s compositional software “Songsmith”.

Johannes Kreidler

Johannes Kreidler: Screenshots from Charts Music (2009)

Ricardo Climent: Oxidising the Spectrum (2004), live game-audio

Oxidising the Spectrum (2004) was born as an interdisciplinary collaboration between composer Ricardo Climent and chemical engineer Quan Gan. This interactive installation explores the possibilities of microbial electrochemistry in the compositional environment. To reinvent the chemistry laboratory as a musical instrument, the composer conceived a system, which could generate and manipulate biological patterns using Microbial Fuel Cells (MFCs) to generate electricity for musical mapping. It includes five families of microbial cultures (the Microbial Ensemble), which behave as a musical quintet, while low voltages are converted into musical expression during the live performance. Compositionally, the manipulation of live organisms seeks to “re-engineer the process of sonification” by reconstructing electrical patterns that are sonically tested. After being trained by Dr Gan for a year at the chemistry laboratory at Queens University of Belfast, Climent constructed the interactive system and the piece.

This live bio-simulator virtual version was first presented at the ZKM’s sonification symposium in 2016, created in the Unreal Game Engine 4. It mimics the microbial system from the original installation and its original dataset to map the musical sound-world. Therefore, it is biologically safe, since the microbes are virtual.

Ricardo Climent

Ricardo Climent, Performance im Temple Bar Music Centre, Dublin (2006), Foto: Ima Pico

Falk Morawitz: Spin Dynamics (2016), acousmatic composition, 8-channel

Spin Dynamics is an acousmatic composition exploring the use of sonified hydrogen-1 and carbon-13 nuclear magnetic resonance data in an electroacoustic music context. Nuclear magnetic resonance experiments excite molecules to produce electromagnetic radiation in the audible frequency range with unique frequency patterns and timbres for every molecule. Given that there are far more than 50 million structurally different organic compounds, the potential sounds created are hugely varied and diverse. Their use in musical composition however is almost unexplored. In this piece, around 100 organic compounds have been selected and sonified via their hydrogen and carbon nuclear magnetic resonance data. The sound selection and arrangement purely follows aesthetic concerns, with each section of the composition highlighting different aspects of the raw molecular sound material.

Falk Morawitz

Falk Morawitz, Graphic of nuclear magnetic resonance (2014)
Falk Morawitz, Grafik of Spin Dynamics (2016)

Åsa Stjerna: Vom Himmel holen (2017), performative presentation of a permanent 16-channel sound installation in Gothenburg,

Premiere

Vom Himmel holen is an artistic sonification of the sky over Sahlgrenska hospital in Gothenburg, Sweden. A glass ceiling in the atrium of the hospital allows for a clear view of the sky, which will be sonified and interpreted from within the building. Information recorded by a weather station on the roof of the hospital, such as temperature, windspeed, precipitation, air pressure etc., will be sent to a computer in real-time. The sound of the installation will be synthesized and transformed in direct correlation with the data. The sound will move in a vertical axis along the sixteen loudspeakers which are imbedded in the wooden wall cladding. The speakers span the entire length of the atrium – from the ground into the sky.

At the Villa Elisabeth, the sound will be generated in real-time in direct connection to the weather data being recorded in Gothenburg. Within the hall, the sound will be interpreted as a performance and combined with the documentation material of the development and construction processes.

Programming (installation and performance) • Andre Bartetzki, Technical concept and construction (installation) • Manfred Fox

Åsa Stjerna

Åsa Stjerna: Sketches and photos of the installation at Sahlgrenska Hospital in Göteborg (2016)

Jasmine Guffond, Listening Back (2017), live-electronics, projections and drummers

Premiere, commissioned by BGNM

Before cookies, the Web was essentially private. After cookies, the Web becomes a space capable of extraordinary monitoring. (Lawrence Lessig)

Listening Back is a live performance that exposes the proliferation of ubiquitous online surveillance via the real time sonification of internet tracking cookies.

Named after the computer science term “magic cookie”, internet cookies are commonly used for data profiling by advertising, corporations and governments, by placing a small file on the user’s computer. Since its origins in 1994, internet cookies have become ubiquitous, fundamentally altering the nature of surfing the Web from being a comparatively anonymous activity, to the kind of environment where records of one’s transactions, movements and even desires can be stored, sorted, mined and sold. The relative invisibility of digital surveillance, and the proliferation of consumer modes of online surveillance have both intensified and rendered ambivalent our relationships to being surveyed. Sound will provide a means for listening back to some of the imperceptible surveillance infrastructures that monitor our habitual online browsing.

Jasmine Guffond

Jasmine Guffond, Excerpt from the programming code for Listening Back (2017)

Jasmine Guffond

Panel Discussion

Klang Kunst Wissen – The radio series “Sonarisationen” on Deutschlandfunk Kultur

In the series “Sonarisationen”, artists and scientists alike produce sensual soundspaces from abstract data. Simultaneously, they research the interaction between aesthetic diversities and informative clarity. Between these two aspects there is a vast space of knowledge to be explored. Many are interested in its exploration, but few follow through with the opportunity. Listening enables a direct access point to phenomena, which are hard to grasp in the form of graphs or text. Whenever there is some spare space in their radio art programming, Deutschlandfunk Kultur offers the opportunity to present the outcomes of these projects. Until now, the following editions have been presented:

Tweetscapes

What does it sound like when Germany twitters? How does the social network tick live? Sound artist Anselm Venezian Nehls and sonification researcher Dr Thomas Hermann tap into the data stream of the Twitter network. Award of Distinction at Prix Ars Electronica 2012.

http://www.deutschlandfunkkultur.de/klangminiaturen‐tweetscapes.1387.de.html?dram:article_id=297229

Bonner Durchmusterung (siehe auch Konzertprogramm)

What does a pulsar sound like? Does the galaxy have a rhythm? Composer Marcus Schmickler and audio-informatics researcher Alberto de Campo attempt to answer these questions. Their project Bonner Durchmusterung refers to a map of the stars with the same name from the 19^th century.

Leftovers

In collaboration with the Experimental Studio for Acoustic Art, Freiburg, the composer Hannes Seidl developed an inverted MP3 filter. The filter renders parts of the sound that are normally cut-off by the compressor audible. In his work Leftovers, this ‘acoustic waste’ of our digital throw-away society will be presented.

http://www.deutschlandfunkkultur.de/klangminiaturen-leftovers.1387.de.html?dram:article_id=293381

Operation Olympic Games

Under the alias “Operation Olympic Games”, the US government conducted the attempted sabotage of the Iranian nuclear program by using computer viruses. In reference to this, James Hoff infiltrates our listening habits by infecting popular music with the structures of common malware.

http://www.deutschlandfunkkultur.de/klangminiaturen-operation-olympic-games.1387.de.html?dram:article_id=315324

KLIMA|ANLAGE

Everyone talks about the weather. Now, in the 21st century, this normally true observation has changed slightly: now everyone talks about the climate. The interpretation of temperatures, precipitation, air pressure etc. is highly disputed depending on economic, social or politic interests. Together with sonification researchers from the University of Bielefeld and the University of Graz, sound artist Werner Cee has created an interactive sound object in form of an installation. This object can render the climate values and model calculations from between 1950 and 2100 audible. This means that patterns and developments will become far easier to understand than in conventional graphs and charts.

http://www.klima-anlage.org/

Knowledge Link through Art and Science

Deutschlandfunk Kultur is currently a partner of the Artist-in-Residence Program “Knowledge Link through Art and Science” (KLAS). Within this framework the Max Planck Institutes for Colloid and Interfaces and Molecular Plant Physiology have invited artists to develop projects at the Wissenschaftspark Potsdam-Golm and the University of Groningen (Netherlands). Within an eight-month period, the artists will be working side-by-side with scientists to create works which attempt to connect the dots between contemporary art concepts and scientific research.

Marcus Gammel

Werner Cee, Abbildung aus Klima|Anlage

Concert: Kairos Quartet

Iannis Xenakis: ST/4-1,080262 (1962) for string quartet

https://www.youtube.com/watch?v=N46ARjDGsQI
Xenakis‘ work is one of the first computer-generated compositions. As a pioneer, Xenakis can be considered a reference for composers who, in a further step, incorporate the sonification of data.

Explanation of the title as shown by its components: ST/4-1,080262: ST = stochastic music. Stochastic in mathematics means aleatory, by chance, subject to probabilities, and was introduced by Jacques Bernoulli. 4-1 = first work for 4 instruments. 080262 = 8th February 1962, the date when this work was calculated by the electronic brain [computer].

ST/4 is a version for four strings of the work ST/10 for 10 instruments, which was calculated by the electronic brain 7090 IBM in Paris in obedience to a special stochastic (probabilist) “programme” devised by Xenakis. This “programme” was derived from the thesis of “Minimum Rules of Composition”, which had been formulated in Achorripsis, but it was not until four years later that it became possible to have it “mechanised” at IBM-France.

The “programme” is a complex of stochastic laws which the composer had been introducing into musical composition for a number of years. He orders the electronic brain to define all the sounds of a sequence, previously calculated, one after the other. First, the time of its occurence, next its kind of timbre (arco, pizzicato, glissando, etc.), its instruments, its pitch, the gradient of its glissando where that occurs, the duration and dynamic of the emission of sound. This Quartet makes use of every way of playing these stringed instruments […].

Preface to the score, Boosey & Hawkes, 1968

Lula Romero: Dérive (2017) for string quartet and live-electronics

Premiere, commissioned by BGNM

Dérive (2017) for string quartet and live-electronics explores the aesthetic consequences of different ideas of the role of subjectivity in sonification processes, the concept of “dérive” (drift) and the notion of musical structure as a translation of a real physical space.

Processes of sonification always contain an element of subjectivity in their interpretation of data turned into musical parameters or musical transformations. However, as the molecular biologist and philosopher Hans-Jörg Rheinberger [“Experimental systems: difference, graphematicity, conjuncture”, in: Florian Dombois et al. (eds.), Intellectual birdhouse: artistic practice as research, Cologne 2012, pp. 89–99] points out, the data collected in scientific experiments are not strictly objective, they are rather representations of phenomena. Data, therefore, do not present the phenomena itself; instead they represent it. Hence, they include an element of interpretation and thus subjectivity. Following this idea, the piece Dérive explores the repercussions of this element of subjectivity, not only in the translation of data into music, but also in the collection and creation of data themselves. The project, therefore, has two parts: the collection and creation of data and their sonification in a work for string quartet and live-electronics.

Collection of data

The data to be sonified in the piece are the data collected by a walker (myself) in a ‘Wanderung’, a ‘dérive’ with the duration of an hour through the city of Berlin. I installed a tracking application on my smart phone that recorded my path. The application also provided different tools for recording and attaching data and media files (text, video and audio recordings), which were used to record particular observations, impressions, thoughts and decisions. In addition, I created field recordings during the walk. Like in Guy Debord’s concept of the ‘dérive’, the walk was dictated by subjective decisions in a specific environment. The method proposed by Debord “entails playful-constructive behavior and awareness of psychogeographical effects”. In a ‘dérive’, “one or more persons during a certain period drop their motives for movement and action, their relations, their work and leisure activities, and let themselves be drawn by the attractions of the terrain and the encounters they find there” [Guy Debord, “Theory of Dérive” (1958), quoted from: Nomadic Trajectories, ed. by John Sellars, in: Warwick Journal of Philosophy, Vol. 7, (1998), pp. 7]. Therefore, every change of direction in the walk and the changing velocities of walking were motivated by the urban architecture, environment and people, by taste, curiosity or aversion, but they were also motivated by discomfort or fear. These decisions are recorded in a walk diary. The set of data from a walk in the area of Kreuzberg was collected to be sonified in the piece. There are two kinds of data:

Quantitative data:

• Movements, trajectories and the area covered walking as collected by the tracking application. (Trajectories and movements were marked with a red line on the map. Beginning of the walk signified by a red triangle, the end by a red square. The walked area is marked as red area on the map.)
• Duration and velocities of the trajectories (data collected by the application) and pauses (marked on the map by blue dots)

Qualitative data – “Walk diary”:

• Events and motivations for each change of direction (marked on the map by green dots.)
• Subjective impressions recorded in photos, texts, sound recordings, videos
• Field recording.

Aesthetic implications

The use of a concrete physical space, in this case an urban space, as a source of data for the creation of a musical piece has aesthetic consequences. The data of the trajectories and velocities of the walk are used both for the structure of the piece and for its spatialization. A fluid and open space provides a fluid and continuously changing form and space different from the compartmentalized structure of musical pieces; a form in continuous development and developed by its own material, its own physical space; a form, therefore, that is constructed by movement and exists in relation to time more than to architectonic forms. A form that also discovers the scars of the city, its failures of planning, its ‘misuses’, negating any pretension of harmonic form.

Still, the urbanism of Berlin – like most of the European cities whose current configuration is the product of its developments during the Enlightenment and Idealism of the 18^th and 19^th centuries – constrains the movement of the walker to the orthogonal trace of the city. In the case of Berlin, this geometric structure is perforated and complicated by the traces of the Second World War and the division of the city. It would be interesting for future pieces to explore cities such as Venice or Seville in a similar manner, cities whose configurations still bear the traces of a more chaotic and rhizomatic urbanism of the Middle Ages.

Political/social implications. Nomadic movements

Through the decisions and itinerary of the walker, in what could be seen as an auto-ethnographic research, different political and social aspects of the city could be made explicit: How the public spaces and the urban architecture are managed and traced, how hetero-patriarchal and capitalist ideologies are reflected in the urban architecture and in its uses. It can also show for which uses and for whom the city is created: for pedestrians or traffic use, for shopping, for resting or contemplation, for meeting, for which gender, age or socioeconomic group, as well as the new subversive uses of the spaces that people create by themselves. Kreuzberg is a heterogeneous, poor and international place with friction caused by the coexistence of different socioeconomic groups. The descendants of Turkish migration, new migrants of the global south, migrants from other areas in Germany, ‘sans-papiers’, artists and party tourists coexist in a demographically diverse and dense place dealing with problems of poverty, gentrification and capitalism. Hence, the intention of this piece is neither to create a cheerful collage of this part of Berlin nor is it to demonize it. It is rather a way to make this reality and the collective visible, to present or “re-present” something that is rendered invisible, ignored or disregarded. Although this presentation does not aim to be a definition of the problem but rather, in the sense of Rosi Braidotti [Nomadic Subjects. Embodiment and Sexual Difference in Contemporary Feminist Theory, New York 1994], a “nomadic figuration”: an explanation of an ever-changing situation in continuous flux that materialized itself in a fluid musical piece.

Interpretation of the data

The data collected provide the basis for the development of the macro- and meso-structure of the piece and a model for the spatialization of the sound.

The temporal range of 60 minutes and the different speeds and rhythms created in the walk are reduced by dividing them by four (total duration 15 minutes). These are then used to structure the piece and its speeds, velocities and rhythms.

The total area covered by the walk is reduced to the dimensions of the performance space (the hall of the Villa Elisabeth) in which the sound sources (four instruments of the quartet and four loudspeakers) are placed in such a way that they trace the contour of the walked area. The members of the audience are inside this area. The trajectories of the sound material created between the instruments and speakers will emulate the ‘dérive’ of the walker.

The events in the “walk diary” will be translated into musical events that trigger not only changes of the sound’s trajectory between the sound sources, but also changes in registers (‘dérive’ in the “vertical space” of the sound), densities of materials, amplitude, textures and quality of the spectrum. Elements of the field recordings are transformed and transcribed and thus used as material for the string quartet and for the electronics. This translation or mapping can only be understood as a very subjective interpretation. That, however, does not mean, that the music will recreate, in a simplistic translation, the ‘feelings’ of the walker, rather the events of the diary will provide the gradation of the changes and determine the categories of the above mentioned changes.

Lula Romero

Lula Romero, Dérive-Karte und Zeitübersicht zu Dérive (2017)

Luc Döbereiner: Auflösung (2017) for cello and live-electronics

Premiere, commissioned by BGNM

Theories of sonification distinguish between information source or data source and the translation of this data into an acoustic signal, a process which makes relations, properties and structures in the data sets audible. Fluctuations and patterns in the initial data which exceed perceivable temporal and spatial orders of magnitude, as well as data which is coded into non-audible media are thus rendered audible and in turn perceivable. With Auflösung, I am less interested in the audible presentation or transfer of non-musical or scientific data and structures, but rather in the interpretation of the instrumental sound itself as a source of data. Sonification often focuses on the idea of sound as a carrier of meaning – something through which data can be rendered audible or sensually perceivable. In the composition Auflösung, for cello and live-electronics, I focus on the “sonification of sound itself”. What interests me the most about this is the exploration of how different temporal layers affect each other and how structures can be transferred between them and are thus rendered perceivable. Spectral properties such as noisiness, fluctuation, focus of spectral energy, bandwidth and density of sonic events amongst other analyzable information form the basic data which is used to control the sound synthesis process. The resulting sound is played back via a transducer attached to the cello. Sonification occurs through the transfer from one medium to another. I understand this process as a form of “transduction”, a concept developed by Gilbert Simondon that refers to a process of form generation that involves transference and expansion:

“This term [transduction] denotes a process – be it physical, biological, mental or social – in which an activity gradually sets itself in motion, propagating within a given area, by basing this propagation on a structuration carried out in different zones of the domain: each region of the constituted structure serves as a constituting principle for the following one, so much so that a modification progressively extends itself at the same time as this structuring operation. […] The transductive operation is an individuation in progress.” (Gilbert Simondon, “The genesis of the individual” [1964], reprinted in: Jonathan Crary, Sanford Kwinter (eds.): Incorporations, New York: Zone Books, 1992.)

It is thus the tension between the different domains that produces the dynamic of the process. In Auflösung, sonification is understood as an operation within an open feedback network, functioning as a transductive individuation of sound by means of a transfer. What I find interesting is the transition between meaning and material and the tension generating difference that emerges through the process of sonification. The cellist, analysis and synthesis are together understood as a heterogeneous system with inner boundaries. A system which is characterized through the non-linear mapping of parameters from the actions of the instrument, its analysis and the synthesis of sound. In Auflösung sound pervades various media as data streams, voltage and mechanical vibrations and goes through material transformations, measurements, parameter-mapping, synthesis and analyses. The range of data streams connects various temporal layers. What will be sonified and made audible are aspects of the sound, which develop over long or very short periods of time and are not graspable in the ephemeral instrumental sound event. Other aspects include patterns and relationships, which only become apparent after the sound has been analytically broken down.

The re-sonified properties, which are projected back onto the cello, create on the one hand new temporal layers in the form of a “resonance” – consisting of micro and macro temporal changes in the sound. And, on the other hand a feedback that occurs, within which, the sonic properties of the sonification itself become the subject of analysis. Concretely, what can be heard are simultaneously the analysed properties of the sound and its development through the feedback, as well as the operation of the system and the analytical-parametric dissection of the sound itself. “Auflösung”, i. e. dissolution, simultaneously refers to a technical measurement, of the breaking down of a phenomenon in the context of analysis, as well as its disappearance.

While sonification usually renders perceivable a form of meaning in the initial data, this piece is rather based on multiple layers of meaning in the instrumental sound which is transferred into data. The instrumental sound produces the control data for the sound synthesis. The cellist interacts with this system and plays the instrument together with the sonified sounds. The meaning of the instrumental musical material exceeds what is directly audible. Through its sound, the cello becomes a controller for the live-electronics. In this context, sonification is understood as a compositional perspective for the development of a performative form of interaction between the musician and technology.

Luc Döbereiner

Luc Döbereiner,Graphic and photo for resolution (2017)

Knut Müller: Thorn (1996) fOr STRING quartett

Thorn for string quartet was created in 1996 as a pitch-time diagram with the help of a graphical method of composition. Parts of the composition were sketched onto a piece of graph paper and subsequently transcribed into musical notation.

Thorn is inspired by the story of the same name by Swedish-American writer Lars Gustafsson (1936–2016). In the story, the first-person narrator searches an old library for engravings and maps which help trace the development of the city of Thorn – today known as the Polish city Torun. One detail in the maps awakes his interest: a house with a weathervane. Subsequently, he begins searching map after map in an attempt to find this house again. Every now and then the house appears but only partly visible – covered by the sight of new buildings. After a while, he begins to believe that the house has completely disappeared due to destruction from war or the ever-changing landscape of the city. In an unexpected turn of events, he finds the house again in a later engraving, but in an entirely different part of the town. He questions whether it was indeed the same house or a new one which had been built to its exact specifications. For me, the story also illustrates a problem with the interpretation of music – the awakening of sound from notation. Like a musician with a score, the narrator penetrates the structure of the sketches and in turn animates the lifeless figures in order to tell a story in time.

Thorn consists mostly of glissandi. The musical building block within this dynamic system is a concealed yet ever-present chord. This specific tetrad, i. e. a chord of four voices (with the ambitus of a fourth), is constantly deformed through the power of the constant movement. It is heard as complete or in parts depending on its possible position. Through the flowing undertow of pitch changes and the perception of various dynamic energetic transitions and energetic states, the listener begins to lose their overview of the piece’s form. However, the harmonic presence of the chord, the differentiation between sections and the bundling of the instruments into a meta-instrument mean that the piece creates a new form – just like the way a riverbed dictates the form of the flowing water.

Thorn was awarded a prize at the 1996 International Composition Contest in Klagenfurt.

Knut Müller

Martin Iddon: Mohl ip (2009/10) for string quartet

https://soundcloud.com/search?q=martiniddon

The title, Mohl ip, is a transliteration of a Korean term which refers to the purple or pale blue light seen with eyes closed during the early stages of meditation. While the piece is not intended to be in any way literally programmatic, Mohl ip demands, in no small part, extremely controlled, fluid physical gestures of the performers. As much as this is audible music, it is, too, also physical, visible music: the physical motions of the performers articulate slowly shifting ratios which represent complex, but incremental changes of underlying tempi, through shifts of physical activity which result in changes of timbre at least as much as pitch. As such the performing body is conceived of as a sort of suture between this numerical representation of gradually shifting tempo curves and the audible result, which maps these data through timbre. The performing body, then, is the medium through which sonification visibly, as well as aurally, takes place. The piece’s physical theatre is, thus, of vital importance, and should be both undertaken and viewed in mind of the sorts of control normally seen in dance or in martial arts such as tai chi.

Martin Iddon

Terry Fox: Berlin Wall Scored for Sound (1980/81), realized as an instrumental score for string quartet by Arnold Dreyblatt (2017)

Terry Fox’s work on the Berlin Wall consists of various sketches and drawings under the title Berlin Wall Scored for Sound which were developed during his stay in Berlin as a DAAD fellow in 1980/81. In many of these drawings the outlines of the Berlin wall were laid over a topographic system, in which spatial coordinates are mapped to time durations, and contours are categorized and identified by letters of the alphabet. An audio realization based on these drawings uses sound recordings from Terry Fox’s own personal audio performance archive, and was issued in 1988 under the title Berlino (Het Apollohuis, Eindhoven).

“On a large map I located four ‘corners’ in the wall surrounding West Berlin. These corners or ‘points’ thus divided the wall into four sections. A straight line was drawn through each section from point to point. When the four sections were joined end to end, the map of Berlin became a very long straight line with the pattern of the wall zig-zagging and looping through it. Four more lines were drawn, evenly spaced and parallel to this center line, two above it and two below, creating a musical stave. The entire length of the wall was measured from the map in centimeters. The centimeters were then transposed into seconds so that distance became measured in time. The topographical or geometrical peculiarities of the wall were then divided into five categories and assigned letters (E, G, B, D, F). One strange formation of the wall, resembling the Horsehead Nebula, was given its own letter: X. […] The complete score, for six different sounds, is endless, forming a loop, like the wall it describes.”
(Terry Fox)

In 2015, together with Dr. Angela Lammert, I curated an exhibition of Fox’s work entitled, Elemental Gestures at the Akademie der Künste in Berlin for which I realized a spatial room installation of Berlino in collaboration with the Electronic Studio as one of three sound rooms. As part of the accompanying performative program, I also conceived an instrumental version of Berlin Wall Scored for Sound for brass instruments, which was premiered on November 11, 2015.

In my interpretation of Terry Fox’s score, I interpreted the assigned letters in the drawings as musical pitches, with the exception of “X” which I have mapped to “silence”. I found it interesting that the letters of the alphabet, which he chose, could be sounded as music. Furthermore, I have noted that his work often contains musical references and could be understood as a kind of “open” score for possible performance. I applied the precise durations for each letter/pitch found in the drawing, resulting in a linear composition of 15 minutes and 32 seconds. In preparing this realization, I kept in mind the resonating sustaining sonorities of Terry Fox’s legendary sonic performances on long piano wires in architectural spaces, as well as his collaborations with instrumentalists (for example the cellos and double bass in Rallentando, 1988) and my own background as a minimalist composer – these have all served as a guide. In this performance, the instrumentalists sustain each “note” without vibrato or dynamic changes and are encouraged to explore harmonic partial vibrations while holding each pitch for the assigned duration. During each pitch block, the musicians may choose a particular octave for the duration, holding this note until the next pitch change. This new version, performed by the Kairos String Quartet, comes closest to Terry Fox’s lifelong exploration of harmonic string vibration.

Arnold Dreyblatt

Marcus Schmickler: Bonner Durchmusterung (Bonn Patternization) (2009), 9-channel audio

http://piethopraxis.org/projects/bonner-durchmusterung/

The eponymous starting point of our project is the Bonn patternization (Bonner Durchmusterung) drawn up by the astronomer Friedrich Argelander (1799–1875) and his co-workers. This is not only the most historic work ever to have been conducted in Bonn; it also includes every star that can be seen in the night sky with the naked eye or a small telescope. The observation of the stars was carried out by means of a very primitive but effective procedure: the main observer looked through a solidly installed telescope facing south. The stars of a strip of the sky passed through the field of vision of this telescope. The main observer estimated the magnitude of a star and its height of passage, and gave an audible signal (a stamp of the foot) at the moment the star moved across the middle of the telescope’s crosshairs. A second observer sat in front of a clock and recorded the time for every signal. More than a million observations of the stars were carried out in the course of the patternization, resulting in a directory documenting more than 300,000 stars. Our project, The Bonn Patternization attempts to attain an epistemological exchange between music and astronomy; it attempts to gain non-verbal knowledge through art and introduces narrativity to science. The basis of our sonifications consists of readings from different stars, star clusters and galaxies, as well as their properties such as light, distance and coordinates. In addition, sounds are generated from systems that arithmetically simulate astronomically relevant phenomena such as the interaction between celestial bodies due to gravitation.

1 Reionization / Dark Ages

300,000 years after the Big Bang matter had cooled down enough for the first atoms to form. The two predominant elements were helium and hydrogen, whose spectrums are sonified here. In the case of stars, the spectral lines reveal surface temperature and chemical composition and, together with the absolute magnitude, the weight of the created star.

2 Solar eruptions

Solar flares are clear proof that the sun is in no way the quiet star that it sometimes appears to us from Earth. A solar flare is a formation of increased radiation within the chromosphere of the sun, which is thrown outwards through magnetic field energy. These eruptions even have an influence on the weather on Earth. We hear the 600 sunbursts that were recorded between 1 January and 30 April 2000.

3 Eccentricity of the elliptical orbits of our solar system

From the physical laws follow relationships between orbital parameters such as the semi-major axis of a planetary orbit and the orbiting time of the planet. The role of the observer, who is himself on the moving planet Earth, plays an important role in interpretation, for example in declining movement. The excentre value and the length of a year on the planets and the asteroid belt between Mars and Jupiter are sonified.

4 Historical maps of the cosmic background radiation

The properties of radiation allow conclusions to be drawn about the properties of the celestial bodies emitting it. In this way precise measurements of the observation angle deliver information on the position and structure of the celestial body in question and examination of the spectrum indicates the chemical composition, the temperature and the movement in the direction of the observer. In addition to electromagnetic radiation, demonstrably cosmic particles provide further information. For the future the evidence of gravitational waves promise a new type of observation of objects in space, such as neutron stars or black holes. Five different maps are sonified and visualized.

5 The Bonn patternization

Argelander’s cartography only supplies us with information on magnitude and coordinates. The first 200 objects are selected five times, and each time the duration of the final note is doubled until a static spectral cluster is created. This cluster is harmonized in the next step. The background for this is the consideration that, if the universe was infinite in time and space, the cosmos would be brightly lit (Olbers’ paradox).

6 Gravitation models

How does it sound when galaxy clusters of 30 objects reciprocally influence each other by means of gravitation? We first hear the collisions of two and subsequently three simulated galaxies. Gravitation is one of the forces in the universe with the greatest effect, and it appears to operate differently on Earth than it does on a grand scale between galaxies which are great distances apart. In April 2009, scientists of the Argelander Institute called Newton’s law of gravity into question.

7 Pulsars / neutron stars

Together with seven other European institutions, the Max Planck Institute for Radioastronomy in Effelsberg has undertaken a comprehensive cataloguing of pulsars. Each pulsar has a specific rotation profile. Using a special synthesis method, 16 of these profiles are sonified into properties such as dynamic, repetition velocity, formant frequency and spatialization. The discovery of the first planets outside the solar system was considered a scientific sensation. In 1992 scientists detected the first exoplanets in orbit around the pulsar PSR B1257+12. In the meantime, however, well over 200 exoplanets in more than 180 systems are known.

8 Expansion / redshift / dark matter / dark energy

The higher the redshift of an astronomical object, the longer its emitted light has been travelling and hence the further back in time we see it. From the redshift, the distance of the object can be determined, although in expanding space-time this can no longer be unambiguously defined. Speckle interferometry is the hazy picture of a point-shaped star that is distorted by the movement of the atmosphere and takes the appearance of a round star when exposed for an extended amount of time; the bending of light leads even more fundamentally to the fact that every observation is altered by the process of observation itself. We sonified the auditive counterpart of the redshift of light, the spectral displacement towards deeper tones.

9 Gamma ray bursts

Gamma ray bursts, often shortened to GRBs, are short, violent outbursts of energy in the universe, accompanied by large amounts of gamma radiation. Their duration ranges from only a few seconds up to a maximum of a few minutes; the only known exception (GRB 060218) lasted 33 minutes. In ten seconds they release more energy than the sun does in billions of years. We sonified the scaled duration, intensity and light curve of eight different GRBs.

10 Quantum spectrae / multi-dimensionality

Quantum physics is the field of physics concerned with the behaviour and the interaction of the smallest particles. In and below the order of magnitude of molecules, experimental measurements produce results that contradict classical mechanics. In particular, certain phenomena are quantized, i. e. they do not run continually, but rather occur only in certain proportions – the so-called quanta. In addition no meaningful difference between particle and wave is possible, because the same object behaves either as a wave or a particle depending on the kind of investigation. The particles each have different spectral properties, which are sonified. We have attempted to portray the discontinuity of the behaviour in space as a tonal paradox, as an auditive wormhole.

Commissioned by IYA 2009 (International Year of Astronomy) and Deutscher Musikrat, premiered at Kunst- und Ausstellungshalle der Bundesrepublik Deutschland, Bonn (May 2009).

Marcus Schmickler • Composition, Alberto de Campo • Sonification, Carsten Goertz • Projection, Dr Michael Geffert • Supervision

Marcus Schmickler

Marcus Schmickler, Bonner Durchmusterung (2009)

Concert Dahinden-Kleeb-Babel

 

Alvin Lucier: Copied Lines (2011) for trombone and thirteen strings

http://www.alvin-lucier-film.com/panorama.html

Alvin Lucier: Copied Lines (2011) for trombone and thirteen strings

During the course of the performance, a trombonist plays ascending and descending glissandi, outlining the skyline of the Williams Fork Mountain Range as viewed from Ute Pass, Colorado. While he does so thirteen string players trace these glissandi at different pitch intervals above and below the trombone glissandi, encompassing a range of a minor 9th. The violins are stacked in semitones above the trombone, the violas and cellos in stacked semitones below. The trombonist determines the speeds of the glissandi; the string players try to follow his variable tempi. Discrepancies in tuning will cause desirable audible beating among the instruments. From time to time the soloist stops playing, leaving gaps in the rising and falling glissandi. However, during these silences he continues moving his slide as if the glissandi were continuing to sound, the string players move their bows up and down silently as well, all the while sliding their left hands up and down following the trombonist’s slide movement. The entire ensemble resumes sounding at the pitch they would have arrived at if the sweeping had been sounding continuously. Timings written in Arabic numerals above the score and parts at 1-minute intervals are given as approximations only. The trombonist is free to interpret the temporal aspect of his line freely following the spatial contour of the line.

Alvin Lucier in the score, Frankfurt am Main: Material Press, 2011

Originally published as Panorama II, referring to his composition Panorama (1993), Lucier changed the title to Copied Lines in 2017. (JHS)

Dahinden, Kleeb, Babel: Free Lines I and II (2017), two improvisations for trombone, piano and percussion

The trio weaves its improvisations into a fluctuating-pulsating sound cocoon. Dahinden-Kleeb-Babel spin a net of delicate piano scales, shimmering cymbals, grooving multiphonics, flashing piano staccati, breakneck trombone phrases, polyrhythmic drums, towering piano clusters, driving percussion and blurry trombone melodies. The character of the instruments and a personal sonic language form the background to an imaginary score and swing in a poetic vision of space and time inspired by the paintings of Jackson Pollock. Dahinden-Kleeb have been playing together for 30 years. The two travel to Berlin to meet up with Genevese percussionist Alexandre Babel, who forms the last piece of the puzzle. All three are renowned players of their instruments. The trio is their new project.

Roland Dahinden

Alvin Lucier: Panorama (1993) for trombone and piano

(Dedicated to Hildegard Kleeb and Roland Dahinden)

In the spring of 1993, Roland Dahinden and Hildegard Kleeb gave me a panoramic photograph of the Swiss and Austrian Alps, seen from their hometown of Zug, Switzerland. I was planning a skiing trip to Switzerland and had asked them to bring me back some travel brochures. At the same time I was thinking about composing a piece for them. As soon as I saw that photograph I got the idea to transcribe the mountain ranges into musical notation. The trombonist would “draw” the mountains by sliding continuously – Dahinden is an expert skier – throughout the piece, breathing when necessary. The pianist would punctuate the mountain peaks. Since the sliding pitches of the trombone would seldom match exactly the fixed tones of the piano, the discrepancies would be heard as audible beats, bumps of sound that occur as sound waves coincide. Panorama was especially written for Kleeb and Dahinden.

Alvin Lucier

Alvin Lucier, Panorama (1993), model (mountain panorama) and extract from the score in the manuscript. With thanks to Volker Straebel. © Alvin Lucier

Mio Chareteau: White Piece (2016) for pianist

In her work, White Piece, Mio Chareteau puts a simple gesture in the spotlight and rethinks the act of the classical piano piece. A white page, an indeterminate composition, a pianist who does not touch her instrument, but treats it with distance and restraint. On the border between still life, minimal music and meticulous performance. White Piece celebrates the beauty of the most exquisite of all instruments.

White Piece is dedicated to the pianist Hildegard Kleeb.

Mio Chareteau
(A sound installation can be seen during the festival in the gallery zwanzigquadratmeter. See satellite programme.)

Mio Chareteau: Score : White Piece (2016)

Ludger Brümmer: Spin (2014), 8-channel

Both granular synthesis and physical modeling synthesis techniques are able to produce extremely complex, noisy sound structures. In Physical Models complex nonlinear behavior is able to produce rich spectra as well as extremely dense heterogeneous structures using granular synthesis. Another approach to generate complex data can be found in the sonification of data files. It creates a certain sound quality containing strong high harmonics and a fast-moving structure. It is interesting to note that some data files contain a structure with enough redundancies generating pitched sounds and even phrases as well as certain patterns. In Spin, I used this method to interact with the structures found inside data files. The sounds were derived from video or other data files, which were fed as raw data into a sound editor, then pitched down so that the information structure inside the video file became slower and the extremely high harmonics shifted lower in pitch. After modifying these sounds they were cross-composed with other algorithmic sound structures consisting of a certain musical Gestalt. This process resulted in different more or less noisy sounds ranging from hiss to some “dirty” timbres, from repetitive to melodic phrases.

In conjunction with some samples of string instruments and modified voices, I created the narrative form of Spin with the intention to generate an experience of the structures found in the complex world of data. Ludger Brümmer